Deep sequencing reads for stem-loop sequence MI0003515

Stem-loop ID hsa-mir-544a
Reads 
                                                        hsa-miR-544a                         Count     RPM (mean number of reads per million)
AUUUUCAUCACCUAGGGAUCUUGUUAAAAAGCAGAUUCUGAUUCAGGGACCAAGAUUCUGCAUUUUUAGCAAGUUCUCAAGUGAUGCUAAU
.....((((((...((((.((((((((((((((((.(((..((....))...))).))))).))))))))))).))))..))))))..... (-32.60)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000139 1 GEO : GSM532875 normal cervix [ Witten D et al.]
ER0000000159 3 GEO : GSM532895 normal cervix [ Witten D et al.]
ER0000000160 1squamous cell GEO : GSM532896 [ Witten D et al.]
ER0000000164 1squamous cell GEO : GSM532900 [ Witten D et al.]
ER0000000167 1 GEO : GSM532903 normal cervix [ Witten D et al.]
ER0000000173 4 GEO : GSM532909 normal cervix [ Witten D et al.]
ER0000000178 1squamous cell GEO : GSM532914 [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).