Deep sequencing reads for stem-loop sequence MI0003169

Stem-loop ID

hsa-mir-518e

Reads

              hsa-miR-518e-5p                      hsa-miR-518e-3p                        Count     RPM (mean number of reads per million)
...............CUCUAGAGGGAAGCGCUUUCUG...................................................  2         0.303
.................................................AAAGAAAGCGCUUCCCUUCAGAGU...............  1         14.2
....................................................GAAAGCGCUUCCCUUCAGAGUG..............  1         1.05
UCUCAGGCUGUGACCCUCUAGAGGGAAGCGCUUUCUGUUGGCUAAAAGAAAAGAAAGCGCUUCCCUUCAGAGUGUUAACGCUUUGAGA
((((((((..((((.((((..(((((((((((((((...............)))))))))))))))..)))).))))..)).)))))) (-45.76)

Filter reads

by experiment

Accession	Read count	Tissue	Link	Comment	Reference
ER0000000001	1	embryonic stem cell	GEO : GSM541796		[ Bar M et al.]
ER0000000108	2	melanoma	GEO : GSM458540	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000114	6	melanoma	GEO : GSM458546	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000167	1		GEO : GSM532903	normal cervix	[ Witten D et al.]
ER0000000177	1		GEO : GSM532913	normal cervix	[ Witten D et al.]

References

1. PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
3. PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).