Deep sequencing reads for stem-loop sequence MI0003158

Stem-loop ID hsa-mir-520c
Reads
              hsa-miR-520c-5p                       hsa-miR-520c-3p                       Count     RPM (mean number of reads per million)
UCUCAGGCUGUCGUCCUCUAGAGGGAAGCACUUUCUGUUGUCUGAAAGAAAAGAAAGUGCUUCCUUUUAGAGGGUUACCGUUUGAGA
((((((((.((..(((((((((((((((((((((((....((.....))..)))))))))))))))))))))))..)).)))))))) (-51.30)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 42embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000108 4melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000114 16melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000177 2 GEO : GSM532913 normal cervix [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
3