Deep sequencing reads for stem-loop sequence MI0003150

Stem-loop ID hsa-mir-526b
Reads 
            hsa-miR-526b-5p                     hsa-miR-526b-3p                      Count     RPM (mean number of reads per million)
.............CUCUUGAGGGAAGCACUUUCUG................................................  4         0.379
..............UCUUGAGGGAAGCACUUUCUGU...............................................  2         0.189
UCAGGCUGUGACCCUCUUGAGGGAAGCACUUUCUGUUGUCUGAAAGAAGAGAAAGUGCUUCCUUUUAGAGGCUUACUGUCUGA
((((((.((((.(((((.((((((((((((((((.((.(.....).)).)))))))))))))))).))))).)))).)))))) (-46.40)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 39embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000108 2melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000114 10melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000150 1squamous cell GEO : GSM532886 [ Witten D et al.]
ER0000000160 1squamous cell GEO : GSM532896 [ Witten D et al.]
ER0000000176 1adenosquamous cell GEO : GSM532912 [ Witten D et al.]
ER0000000186 1squamous cell GEO : GSM532922 [ Witten D et al.]
ER0000000188 1squamous cell GEO : GSM532924 [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
3
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).