Deep sequencing reads for stem-loop sequence MI0003134

Stem-loop ID hsa-mir-494
Reads 
                                                  hsa-miR-494                      Count     RPM (mean number of reads per million)
..............AGGUUGUCCGUGUUGUCUUCUC.............................................  7         0.504
...............................................UGAAACAUACACGGGAAACCUCU...........  196       14.8
...............................................UGAAACAUACACGGGAAACCUC............  7         0.504
...............................................UGAAACAUACACGGGAAACCUCUU..........  4         0.288
...............................................UGAAACAUACACGGGAAACCU.............  4         3.69
..................................................AACAUACACGGGAAACCUCUUU.........  4         0.288
GAUACUCGAAGGAGAGGUUGUCCGUGUUGUCUUCUCUUUAUUUAUGAUGAAACAUACACGGGAAACCUCUUUUUUAGUAUC
((((((.((((((((((((..(((((((((.(((((.........)).)))))).))))))..)))))))))))))))))) (-34.10)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000002 2embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000104 6melanocyte GEO : GSM458536 [ Stark MS et al.]
ER0000000105 231 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000159 1 GEO : GSM532895 normal cervix [ Witten D et al.]
ER0000000167 1 GEO : GSM532903 normal cervix [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
3
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).