Deep sequencing reads for stem-loop sequence MI0000774

Stem-loop ID hsa-mir-302d
Reads 
    hsa-miR-302d-5p                       hsa-miR-302d-3p             Count     RPM (mean number of reads per million)
.....ACUUUAACAUGGAGGCACUUGC.........................................  1         1.77
........................................AAAUAAGUGCUUCCAUGUUUGAGUG...  1         17.6
..........................................AUAAGUGCUUCCAUGUUUGAGUGU..  5         5.26
...........................................UAAGUGCUUCCAUGUUUGAGUGU..  36731     3.91e+04
...........................................UAAGUGCUUCCAUGUUUGAGU....  520       596
...........................................UAAGUGCUUCCAUGUUUGAGUG...  350       378
...........................................UAAGUGCUUCCAUGUUUGAG.....  50        58.3
...........................................UAAGUGCUUCCAUGUUUGA......  7         9.52
...........................................UAAGUGCUUCCAUGUUU........  5         8.13
...........................................UAAGUGCUUCCAUGUUUG.......  3         3.15
............................................AAGUGCUUCCAUGUUUGAGUGU..  19        20.7
.............................................AGUGCUUCCAUGUUUGAGUGU..  40        47.1
..............................................GUGCUUCCAUGUUUGAGUGU..  1         1.05
...............................................UGCUUCCAUGUUUGAGUGU..  3         3.15
................................................GCUUCCAUGUUUGAGUGU..  1         1.05
CCUCUACUUUAACAUGGAGGCACUUGCUGUGACAUGACAAAAAUAAGUGCUUCCAUGUUUGAGUGUGG
((.(.((((.((((((((((((((((.(((......)))....)))))))))))))))).))))).)) (-29.20)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 55164embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000002 2053embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000167 4 GEO : GSM532903 normal cervix [ Witten D et al.]
ER0000000177 1 GEO : GSM532913 normal cervix [ Witten D et al.]
ER0000000185 1 GEO : GSM532921 normal cervix [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).