Deep sequencing reads for stem-loop sequence MI0000746

Stem-loop ID hsa-mir-99b
Reads 
      hsa-miR-99b-5p                        hsa-miR-99b-3p               Count     RPM (mean number of reads per million)
....CCCACCCGUAGAACCGACCUUGC...........................................  17        71.2
....CCCACCCGUAGAACCGACCUUGCG..........................................  16        69.9
....CCCACCCGUAGAACCGACCUUG............................................  3         17.2
....CCCACCCGUAGAACCGACCUU.............................................  1         7.02
.....CCACCCGUAGAACCGACCUUGCG..........................................  13        1.61
......CACCCGUAGAACCGACCUUGCG..........................................  18148     624
......CACCCGUAGAACCGACCUUGC...........................................  3121      109
......CACCCGUAGAACCGACC...............................................  368       5.74
......CACCCGUAGAACCGACCUUG............................................  175       34.9
......CACCCGUAGAACCGACCUUGCGG.........................................  95        1.87
......CACCCGUAGAACCGACCUU.............................................  31        0.674
......CACCCGUAGAACCGACCU..............................................  20        0.359
......CACCCGUAGAACCGACCUUGCGGG........................................  6         0.1
.......ACCCGUAGAACCGACCUUGCG..........................................  122       2.79
.......ACCCGUAGAACCGACCUUGC...........................................  19        0.3
........CCCGUAGAACCGACCUUGCG..........................................  2         7.75
.........CCGUAGAACCGACCUUGCG..........................................  1         0.227
..........CGUAGAACCGACCUUGCG..........................................  8         0.56
............................................CAAGCUCGUGUCUGUGGGUCCGU...  408       8.98
............................................CAAGCUCGUGUCUGUGGGUCCG....  380       12.6
............................................CAAGCUCGUGUCUGUGGGUC......  52        1.21
............................................CAAGCUCGUGUCUGUGGGUCC.....  29        1.91
............................................CAAGCUCGUGUCUGUGGGU.......  8         0.106
............................................CAAGCUCGUGUCUGUGGG........  2         0.0282
GGCACCCACCCGUAGAACCGACCUUGCGGGGCCUUCGCCGCACACAAGCUCGUGUCUGUGGGUCCGUGUC
(((((..(((((((((..(((.((((.(((((....))).).).)))).)))..)))))))))..))))) (-30.00)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 838embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000002 1474embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000103 8011melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000104 1260melanocyte GEO : GSM458536 [ Stark MS et al.]
ER0000000105 5259 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000106 681melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000107 479melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 2819melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 3497melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000110 4551melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 1369melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 2261melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 1406melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 1471melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000135 17 GEO : GSM532871 normal cervix [ Witten D et al.]
ER0000000139 1 GEO : GSM532875 normal cervix [ Witten D et al.]
ER0000000141 14 GEO : GSM532877 normal cervix [ Witten D et al.]
ER0000000147 55 GEO : GSM532883 normal cervix [ Witten D et al.]
ER0000000157 56 GEO : GSM532893 normal cervix [ Witten D et al.]
ER0000000159 14 GEO : GSM532895 normal cervix [ Witten D et al.]
ER0000000161 121 GEO : GSM532897 normal cervix [ Witten D et al.]
ER0000000163 10 GEO : GSM532899 normal cervix [ Witten D et al.]
ER0000000165 213 GEO : GSM532901 normal cervix [ Witten D et al.]
ER0000000167 3 GEO : GSM532903 normal cervix [ Witten D et al.]
ER0000000169 136 GEO : GSM532905 normal cervix [ Witten D et al.]
ER0000000171 99 GEO : GSM532907 normal cervix [ Witten D et al.]
ER0000000173 5 GEO : GSM532909 normal cervix [ Witten D et al.]
ER0000000175 12 GEO : GSM532911 normal cervix [ Witten D et al.]
ER0000000177 16 GEO : GSM532913 normal cervix [ Witten D et al.]
ER0000000179 1 GEO : GSM532915 normal cervix [ Witten D et al.]
ER0000000181 59 GEO : GSM532917 normal cervix [ Witten D et al.]
ER0000000183 10whole body GEO : GSM532919 normal cervix [ Witten D et al.]
ER0000000185 4 GEO : GSM532921 normal cervix [ Witten D et al.]
ER0000000262 8 GEO : GSM337570 antibody: anti-Ago1 4B8
ER0000000263 19 GEO : GSM337571 antibody: anti-Ago2 11A9
ER0000000264 8 GEO : GSM368181 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000265 1 GEO : GSM368182 tissue: clinically negative of NPC [ Zhu JY et al.]
ER0000000266 8 GEO : GSM368183 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000267 1 GEO : GSM368184 tissue: clinically negative of NPC [ Zhu JY et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
3
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
4
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).