Deep sequencing reads for stem-loop sequence MI0000649

Stem-loop IDmmu-mir-101b
Confidence
Feedback: Do you believe this miRNA is real?
Reads
                      mmu-miR-101b-5p                   mmu-miR-101b-3p                            Count     RPM (mean number of reads per million)
.UCUGAGACUGAACUGCCCUUUUU.........................................................................  3         0.00924
.UCUGAGACUGAACUGCCCUUUU..........................................................................  1         0.00338
.UCUGAGACUGAACUGCCCUUUUUCG.......................................................................  1         0.00251
..CUGAGACUGAACUGCCCUUUUU.........................................................................  6         0.0243
..CUGAGACUGAACUGCCCUUUU..........................................................................  6         0.0227
..CUGAGACUGAACUGCCCUUU...........................................................................  2         0.00575
...UGAGACUGAACUGCCCUUUU..........................................................................  1         0.00654
....GAGACUGAACUGCCCUUUUU.........................................................................  4         0.00487
.....AGACUGAACUGCCCUUUUU.........................................................................  12        0.0338
.......................UCGGUUAUCAUGGUACCGAUGCU...................................................  6         0.052
.......................UCGGUUAUCAUGGUACCGAUG.....................................................  4         0.039
.......................UCGGUUAUCAUGGUACCGAU......................................................  3         0.0717
.......................UCGGUUAUCAUGGUACCGAUGC....................................................  1         0.537
........................CGGUUAUCAUGGUACCGAUGCU...................................................  5         0.0303
........................CGGUUAUCAUGGUACCGAUGCUG..................................................  2         0.0183
........................CGGUUAUCAUGGUACCGA.......................................................  1         0.00201
.........................GGUUAUCAUGGUACCGAUGCUG..................................................  1         0.00905
.......................................CGAUGCUGUAGCUCUGAAAGGUA...................................  1         0.0021
.............................................UGUAGCUCUGAAAGGUACAGUACU............................  3         0.00963
.............................................UGUAGCUCUGAAAGGUACAG................................  1         0.00654
.............................................UGUAGCUCUGAAAGGUACAGUAC.............................  1         0.00419
.............................................UGUAGCUCUGAAAGGUACAGU...............................  1         0.000923
.............................................UGUAGCUCUGAAAGGUACAGUA..............................  1         0.00183
...............................................UAGCUCUGAAAGGUACAGUACUG...........................  1         0.0021
......................................................GAAAGGUACAGUACUGUGAUAGCU...................  1         0.00804
..........................................................GGUACAGUACUGUGAUAGCU...................  1         0.000923
..........................................................GGUACAGUACUGUGAUAGCUGAA................  1         0.00397
...........................................................GUACAGUACUGUGAUAGCU...................  333058    917
...........................................................GUACAGUACUGUGAUAGCUGAA................  46701     207
...........................................................GUACAGUACUGUGAUAGCUGA.................  40723     242
...........................................................GUACAGUACUGUGAUAGCUG..................  27295     88.9
...........................................................GUACAGUACUGUGAUAGC....................  6615      19.6
...........................................................GUACAGUACUGUGAUAGCUGAAG...............  516       1.78
...........................................................GUACAGUACUGUGAUAGCUGAAGA..............  315       0.939
...........................................................GUACAGUACUGUGAUAG.....................  115       1.29
...........................................................GUACAGUACUGUGAUAGCUGAAGAA.............  19        0.0548
...........................................................GUACAGUACUGUGAUAGCUGAAGAAU............  1         0.003
............................................................UACAGUACUGUGAUAGCUGAAG...............  58983     386
............................................................UACAGUACUGUGAUAGCUG..................  38739     123
............................................................UACAGUACUGUGAUAGCUGAA................  35561     164
............................................................UACAGUACUGUGAUAGCUGAAGA..............  33357     102
............................................................UACAGUACUGUGAUAGCUGA.................  20380     130
............................................................UACAGUACUGUGAUAGCUGAAGAA.............  1979      5.71
............................................................UACAGUACUGUGAUAGCU...................  98        1.22
............................................................UACAGUACUGUGAUAGCUGAAGAAU............  72        0.203
............................................................UACAGUACUGUGAUAGC....................  47        0.362
............................................................UACAGUACUGUGAUAGCUGAAGAAUG...........  3         0.00616
.............................................................ACAGUACUGUGAUAGCUGAAG...............  3660      15.7
.............................................................ACAGUACUGUGAUAGCUGAAGA..............  3033      10.2
.............................................................ACAGUACUGUGAUAGCUGAA................  1799      6.85
.............................................................ACAGUACUGUGAUAGCUGA.................  1038      4.09
.............................................................ACAGUACUGUGAUAGCUGAAGAA.............  294       0.88
.............................................................ACAGUACUGUGAUAGCUGAAGAAU............  12        0.0272
.............................................................ACAGUACUGUGAUAGCU...................  10        0.375
.............................................................ACAGUACUGUGAUAGCUG..................  8         0.187
..............................................................CAGUACUGUGAUAGCUGAAGA..............  319       1.06
..............................................................CAGUACUGUGAUAGCUGAAG...............  183       0.706
..............................................................CAGUACUGUGAUAGCUGAA................  81        0.353
..............................................................CAGUACUGUGAUAGCUGAAGAA.............  72        0.197
..............................................................CAGUACUGUGAUAGCUGA.................  22        0.18
..............................................................CAGUACUGUGAUAGCUGAAGAAU............  9         0.0468
..............................................................CAGUACUGUGAUAGCUG..................  1         0.0075
...............................................................AGUACUGUGAUAGCUGA.................  46        0.576
...............................................................AGUACUGUGAUAGCUGAA................  24        0.252
...............................................................AGUACUGUGAUAGCUGAAG...............  15        0.11
...............................................................AGUACUGUGAUAGCUGAAGA..............  7         0.0308
...............................................................AGUACUGUGAUAGCUGAAGAA.............  2         0.00672
................................................................GUACUGUGAUAGCUGAA................  20        0.259
................................................................GUACUGUGAUAGCUGAAG...............  7         0.0831
................................................................GUACUGUGAUAGCUGAAGA..............  1         0.0107
.................................................................UACUGUGAUAGCUGAAG...............  3         0.0523
..................................................................ACUGUGAUAGCUGAAGA..............  1         0.00916
AUCUGAGACUGAACUGCCCUUUUUCGGUUAUCAUGGUACCGAUGCUGUAGCUCUGAAAGGUACAGUACUGUGAUAGCUGAAGAAUGGCGGUGCCAUC
.........((.((((((.((((((((((((((((((......((((((.((.....)).)))))))))))))))))))))))).))))))..)).. (-39.70)

Filter reads

by experiment
AccessionRead countTissueLinkCommentReference
ER0000000028 13OvaryGEO : GSM510432 [ Chiang HR et al.]
ER0000000029 709OvaryGEO : GSM510433 [ Chiang HR et al.]
ER0000000030 894OvaryGEO : GSM510434 [ Chiang HR et al.]
ER0000000031 79OvaryGEO : GSM510435 [ Chiang HR et al.]
ER0000000032 118TestesGEO : GSM510436 [ Chiang HR et al.]
ER0000000033 462TestesGEO : GSM510437 [ Chiang HR et al.]
ER0000000034 624TestesGEO : GSM510438 [ Chiang HR et al.]
ER0000000035 86TestesGEO : GSM510439 [ Chiang HR et al.]
ER0000000036 2023BrainGEO : GSM510440 [ Chiang HR et al.]
ER0000000037 6650BrainGEO : GSM510441 [ Chiang HR et al.]
ER0000000038 10727BrainGEO : GSM510442 [ Chiang HR et al.]
ER0000000039 1394BrainGEO : GSM510443 [ Chiang HR et al.]
ER0000000040 49303BrainGEO : GSM510444 [ Chiang HR et al.]
ER0000000041 154Whole bodyGEO : GSM510445Newborn[ Chiang HR et al.]
ER0000000042 659Whole bodyGEO : GSM510446Newborn[ Chiang HR et al.]
ER0000000043 1181Whole bodyGEO : GSM510447Newborn[ Chiang HR et al.]
ER0000000044 224Whole bodyGEO : GSM510448Newborn[ Chiang HR et al.]
ER0000000045 1938Whole bodyGEO : GSM510449Newborn[ Chiang HR et al.]
ER0000000046 2757Whole bodyGEO : GSM510450Newborn[ Chiang HR et al.]
ER0000000047 3303Whole bodyGEO : GSM510451Newborn[ Chiang HR et al.]
ER0000000048 3261Whole bodyGEO : GSM510452Newborn[ Chiang HR et al.]
ER0000000049 3091Whole bodyGEO : GSM510453Newborn[ Chiang HR et al.]
ER0000000050 3135Whole bodyGEO : GSM510454Newborn[ Chiang HR et al.]
ER0000000051 2907Whole bodyGEO : GSM510455Newborn[ Chiang HR et al.]
ER0000000052 24667Whole bodyGEO : GSM510456Newborn[ Chiang HR et al.]
ER0000000053 1123EmbryoGEO : GSM510457Day: 12.5[ Chiang HR et al.]
ER0000000054 3540EmbryoGEO : GSM510458Day: 12.5[ Chiang HR et al.]
ER0000000055 6000EmbryoGEO : GSM510459Day: 12.5[ Chiang HR et al.]
ER0000000056 819EmbryoGEO : GSM510460Day: 12.5[ Chiang HR et al.]
ER0000000057 1598EmbryoGEO : GSM510461Day: 9.5[ Chiang HR et al.]
ER0000000058 3461EmbryoGEO : GSM510462Day: 9.5[ Chiang HR et al.]
ER0000000059 5506EmbryoGEO : GSM510463Day: 9.5[ Chiang HR et al.]
ER0000000060 410EmbryoGEO : GSM510464Day: 9.5[ Chiang HR et al.]
ER0000000061 2083EmbryoGEO : GSM510465Day: 7.5[ Chiang HR et al.]
ER0000000062 4199EmbryoGEO : GSM510466Day: 7.5[ Chiang HR et al.]
ER0000000063 6214EmbryoGEO : GSM510467Day: 7.5[ Chiang HR et al.]
ER0000000216 5888Bone marrowGEO : GSM539835Strain: C57BL/6J; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000217 3576Bone marrowGEO : GSM539836Strain: C57BL/6J; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000218 2565SpleenGEO : GSM539837Strain: C57BL/6J; Gender: male; Isolation: Fluorescence activated cell sorting
ER0000000219 4829SpleenGEO : GSM539838Strain: C57BL/6J; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000220 16073SpleenGEO : GSM539839Strain: C57BL/6J; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000221 9955SpleenGEO : GSM539840Strain: C57BL/6J; Gender: Male; Isolation: CD43 negative magnetic beads selection
ER0000000222 31409SpleenGEO : GSM539841Strain: C57BL/6J; Gender: Male; Isolation: CD43 negative magnetic beads selection
ER0000000223 23740SpleenGEO : GSM539842Strain: C57BL/6J; Gender: Male; Isolation: CD43 negative magnetic beads selection
ER0000000224 11547SpleenGEO : GSM539843Strain: C57BL/6J; Gender: Male; Isolation: CD43 negative magnetic beads selection
ER0000000225 7353Peritoneal lavageGEO : GSM539844Strain: C57BL/6J; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000226 4976SpleenGEO : GSM539845Strain: C57BL/6J; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000227 3310Lymph nodesGEO : GSM539846Strain: C57BL/6J, Gender: Male, Isolation: Fluorescence activated cell sorting
ER0000000228 2992Lymph nodesGEO : GSM539847Strain: IL-6 transgenic; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000229 15172Bone marrowGEO : GSM539848Strain: C57BL/6J; Gender: Male
ER0000000230 28977Bone marrowGEO : GSM539849Strain: C57BL/6J; Gender: Male
ER0000000231 24913Bone marrowGEO : GSM539850Strain: C57BL/6J; Gender: Male
ER0000000232 18740Peritoneal lavageGEO : GSM539851Strain: C57BL/6J; Gender: Male
ER0000000233 3462Peritoneal lavageGEO : GSM539852Strain: C57BL/6J; Gender: Male
ER0000000234 7184Bone marrowGEO : GSM539853Strain: C57BL/6J; Gender: Male
ER0000000235 10643Bone marrowGEO : GSM539854Strain: C57BL/6J; Gender: Male
ER0000000236 10149SpleenGEO : GSM539855Strain: RAG-/- ; Gender: Male
ER0000000237 3893ThymusGEO : GSM539856
ER0000000238 20092SpleenGEO : GSM539857Strain: C57BL/6J; Gender: Male
ER0000000239 29538SpleenGEO : GSM539858Strain: C57BL/6J; Gender: Male
ER0000000240 11918SpleenGEO : GSM539859Strain: C57BL/6J; Gender: Male
ER0000000241 33574Lymph nodes/spleenGEO : GSM539860Strain: C57BL/6J; Gender: Male
ER0000000242 67360Lymph nodes/spleenGEO : GSM539861Strain: C57BL/6J; Gender: Male
ER0000000243 44102Lymph nodes/spleenGEO : GSM539862Strain: C57BL/6J, Gender: Male
ER0000000244 69271SpleenGEO : GSM539863Strain: C57BL/6J; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000245 24254Lymph nodes/spleenGEO : GSM539864Strain: C57BL/6J; Gender: Male
ER0000000246 15914Lymph nodes/spleenGEO : GSM539865Strain: C57BL/6J; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000247 49440GEO : GSM539866Strain: C57BL/6-129
ER0000000248 5765GEO : GSM539867Strain: C57BL/6J; Developmental stage: E13.5
ER0000000249 1835HeartGEO : GSM539868Strain: C57BL/6J; Gender: Male
ER0000000250 17812BrainGEO : GSM539869Strain: C57BL/6J; Gender: Male
ER0000000251 12753LungGEO : GSM539870Strain: C57BL/6J; Gender: Male
ER0000000252 13822LiverGEO : GSM539871Strain: C57BL/6J; Gender: Male
ER0000000253 29710KidneyGEO : GSM539872Strain: C57BL/6J; Gender: Male
ER0000000254 26004PancreasGEO : GSM539873Strain: C57BL/6J; Gender: Male
ER0000000255 29922SkinGEO : GSM539874Strain: C57BL/6J; Gender: Male
ER0000000256 9499Skeletal muscleGEO : GSM539875Strain: C57BL/6J; Gender: Male
ER0000000257 28725Salivary glandsGEO : GSM539876Strain: C57BL/6J; Gender: Male
ER0000000258 2919TestesGEO : GSM539877Strain: C57BL/6J; Gender: Male
ER0000000259 6276OvaryGEO : GSM539878Strain: C57BL/6J; Gender: Female
ER0000000260 24155SpleenGEO : GSM539879Strain: BclXL transgenic BalbC; Gender: Male
ER0000000261 14278Lymph nodesGEO : GSM539880Strain: BclXL transgenic BalbC; Gender: Male
ER0000000415 68NIH-3T3 cellGEO : GSM774079Cell cycle arrest: Contact inhibition; Cell cycle phase: Asynchronous; Cell type: Fibroblast
ER0000000416 604NIH-3T3 cellGEO : GSM774080Cell cycle arrest: Contact inhibition; Cell cycle phase: G0; Cell type: Fibroblast
ER0000000417 926NIH-3T3 cellGEO : GSM774081Cell cycle arrest: Contact inhibition; Cell cycle phase: G0; Cell type: Fibroblast
ER0000000490 142568BrainGEO : GSM995310Age: Adult; Gender: Male[ Meunier J et al.]
ER0000000491 2107CerebellumGEO : GSM995311Age: Adult; Gender: Male[ Meunier J et al.]
ER0000000492 32046HeartGEO : GSM995312Age: Adult; Gender: Male[ Meunier J et al.]
ER0000000493 46505KidneyGEO : GSM995313Age: Adult; Gender: Male[ Meunier J et al.]
ER0000000494 2097TestisGEO : GSM995314Age: Adult; Gender: Male[ Meunier J et al.]
ER0000000510 19232Sertoli cells GEO : GSM995330Age: Pool of individuals; Gender: Male[ Meunier J et al.]
ER0000000511 2453SpermatidsGEO : GSM995331Age: Pool of individuals; Gender: Male[ Meunier J et al.]
ER0000000512 1813SpermatocytesGEO : GSM995332Age: Pool of individuals; Gender: Male[ Meunier J et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).