Deep sequencing reads for stem-loop sequence MI0000490

Stem-loop ID hsa-mir-206
Reads 
                                                       hsa-miR-206                      Count     RPM (mean number of reads per million)
...................................................AUGGAAUGUAAGGAAGUGUGUGGU...........  1         186
....................................................UGGAAUGUAAGGAAGUGUGUGG............  19        2.22
....................................................UGGAAUGUAAGGAAGUGUGUGGU...........  2         0.144
UGCUUCCCGAGGCCACAUGCUUCUUUAUAUCCCCAUAUGGAUUACUUUGCUAUGGAAUGUAAGGAAGUGUGUGGUUUCGGCAAGUG
.((((.((((((((((((((((((((((((..(((((.(.(......).)))))).)))))))))))))))))))))))).)))). (-43.90)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000105 11 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000108 7melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 7melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000184 1squamous cell GEO : GSM532920 [ Witten D et al.]
ER0000000265 1 GEO : GSM368182 tissue: clinically negative of NPC [ Zhu JY et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
2
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
3
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).