Deep sequencing reads for stem-loop sequence MI0000484

Stem-loop ID hsa-mir-188
Reads
             hsa-miR-188-5p                         hsa-miR-188-3p                      Count     RPM (mean number of reads per million)
..............CAUCCCUUGCAUGGUGGAGGGU..................................................  150       5.29
..............CAUCCCUUGCAUGGUGGAGGG...................................................  25        1.49
..............CAUCCCUUGCAUGGUGGAGG....................................................  11        1.06
..............CAUCCCUUGCAUGGUGGAG.....................................................  5         0.842
..............CAUCCCUUGCAUGGUGGA......................................................  1         27.2
..................................................CCCCUCCCACAUGCAGGGUUUGCA............  27        224
..................................................CCCCUCCCACAUGCAGGGUUUGC.............  10        80.6
....................................................CCUCCCACAUGCAGGGUUUGCA............  2         0.77
.....................................................CUCCCACAUGCAGGGUUUGCA............  10        1.76
UGCUCCCUCUCUCACAUCCCUUGCAUGGUGGAGGGUGAGCUUUCUGAAAACCCCUCCCACAUGCAGGGUUUGCAGGAUGGCGAGCC
.((((((..(((..((..(((((((((..((((((....(.....).....))))))..)))))))))..))..))).)).)))). (-39.80)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000002 20embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000103 34melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000104 2melanocyte GEO : GSM458536 [ Stark MS et al.]
ER0000000105 7 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000106 4melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000107 22melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 257melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 10melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000110 66melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 87melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 86melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 52melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 43melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000147 4 GEO : GSM532883 normal cervix [ Witten D et al.]
ER0000000157 8 GEO : GSM532893 normal cervix [ Witten D et al.]
ER0000000161 12 GEO : GSM532897 normal cervix [ Witten D et al.]
ER0000000165 13 GEO : GSM532901 normal cervix [ Witten D et al.]
ER0000000171 15 GEO : GSM532907 normal cervix [ Witten D et al.]
ER0000000174 1squamous cell GEO : GSM532910 [ Witten D et al.]
ER0000000181 5 GEO : GSM532917 normal cervix [ Witten D et al.]
ER0000000183 2whole body GEO : GSM532919 normal cervix [ Witten D et al.]
ER0000000193 1 GEO : GSM532929 normal cervix [ Witten D et al.]
ER0000000263 1 GEO : GSM337571 antibody: anti-Ago2 11A9
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
3