Deep sequencing reads for stem-loop sequence MI0000478

Stem-loop ID hsa-mir-149
Reads
              hsa-miR-149-5p                          hsa-miR-149-3p                       Count     RPM (mean number of reads per million)
..............UCUGGCUCCGUGUCUUCACUCC.....................................................  61        26.2
..............UCUGGCUCCGUGUCUUCACUCCC....................................................  41        49.5
..............UCUGGCUCCGUGUCUUCACUC......................................................  14        23.5
..............UCUGGCUCCGUGUCUUCACU.......................................................  6         10.8
..............UCUGGCUCCGUGUCUUCAC........................................................  1         0.354
..................................CCCGUGCUUGUCCGAGGAGG...................................  1         7.93
......................................................GAGGGAGGGACGGGGGCUGUGC.............  22        0.401
......................................................GAGGGAGGGACGGGGGCUGUG..............  2         0.0288
GCCGGCGCCCGAGCUCUGGCUCCGUGUCUUCACUCCCGUGCUUGUCCGAGGAGGGAGGGAGGGACGGGGGCUGUGCUGGGGCAGCUGGA
.(((((((((.(((.(.(.((((((.(((((.(((((.(.(((....))).))))))))))).)))))).).).))).)))).))))). (-55.80)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 8embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000002 99embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000103 7melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000105 34 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000106 4melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000108 2melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 4melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000113 2melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000140 2squamous cell GEO : GSM532876 [ Witten D et al.]
ER0000000156 2squamous cell GEO : GSM532892 [ Witten D et al.]
ER0000000157 1 GEO : GSM532893 normal cervix [ Witten D et al.]
ER0000000161 1 GEO : GSM532897 normal cervix [ Witten D et al.]
ER0000000164 1squamous cell GEO : GSM532900 [ Witten D et al.]
ER0000000165 1 GEO : GSM532901 normal cervix [ Witten D et al.]
ER0000000168 1adenosquamous cell GEO : GSM532904 [ Witten D et al.]
ER0000000171 1 GEO : GSM532907 normal cervix [ Witten D et al.]
ER0000000174 1squamous cell GEO : GSM532910 [ Witten D et al.]
ER0000000178 1squamous cell GEO : GSM532914 [ Witten D et al.]
ER0000000183 1whole body GEO : GSM532919 normal cervix [ Witten D et al.]
ER0000000186 1squamous cell GEO : GSM532922 [ Witten D et al.]
ER0000000188 1squamous cell GEO : GSM532924 [ Witten D et al.]
ER0000000263 1 GEO : GSM337571 antibody: anti-Ago2 11A9
ER0000000264 3 GEO : GSM368181 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000266 6 GEO : GSM368183 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000267 1 GEO : GSM368184 tissue: clinically negative of NPC [ Zhu JY et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
3
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
4