Deep sequencing reads for stem-loop sequence MI0000269

Stem-loop ID hsa-mir-181a-2
Confidence
Feedback: Do you believe this miRNA is real?
Reads
                                     hsa-miR-181a-5p                    hsa-miR-181a-2-3p                       Count     RPM (mean number of reads per million)
..................GCCUUCAGAGGACUCCAAGG........................................................................  10        0.484
...................CCUUCAGAGGACUCCAAGG........................................................................  15        2.72
....................CUUCAGAGGACUCCAAGG........................................................................  7         0.38
.....................UUCAGAGGACUCCAAGG........................................................................  2         0.141
.....................................GAACAUUCAACGCUGUCGGUG....................................................  58        1.7
.....................................GAACAUUCAACGCUGUCGGUGA...................................................  42        1.54
.....................................GAACAUUCAACGCUGUCGGUGAG..................................................  40        2.9
.....................................GAACAUUCAACGCUGUCGGU.....................................................  34        1.69
.....................................GAACAUUCAACGCUGUCGGUGAGU.................................................  14        0.73
.....................................GAACAUUCAACGCUGUCGGUGAGUUU...............................................  9         0.526
.....................................GAACAUUCAACGCUG..........................................................  1         0.00132
......................................AACAUUCAACGCUGUCGGUG....................................................  39384     1.19e+03
......................................AACAUUCAACGCUGUCGGU.....................................................  10415     373
......................................AACAUUCAACGCUGUCGGUGA...................................................  412       3.27
......................................AACAUUCAACGCUGUCGGUGAGU.................................................  286       2.73
......................................AACAUUCAACGCUGUCGGUGAGUUUG..............................................  157       5.38
......................................AACAUUCAACGCUGUCGGUGAG..................................................  133       8.48
......................................AACAUUCAACGCUGUCGGUGAGUU................................................  68        6.18
......................................AACAUUCAACGCUGUCGG......................................................  46        1.53
......................................AACAUUCAACGCUGUCGGUGAGUUU...............................................  11        2.03
......................................AACAUUCAACGCUGUCG.......................................................  7         1.84
......................................AACAUUCAACGCUGU.........................................................  6         2.46
......................................AACAUUCAACGCUGUC........................................................  4         2.33
......................................AACAUUCAACGCUGUCGGUGAGUUUGGGAU..........................................  3         0.0884
.......................................ACAUUCAACGCUGUCGGUGAGUU................................................  170       8.72
.......................................ACAUUCAACGCUGUCGGUGAG..................................................  121       10.1
.......................................ACAUUCAACGCUGUCGGUGAGUUU...............................................  117       6.18
.......................................ACAUUCAACGCUGUCGGUGAGU.................................................  80        5.95
.......................................ACAUUCAACGCUGUCGGUGA...................................................  37        4.34
.......................................ACAUUCAACGCUGUCGGUG....................................................  20        2.04
.......................................ACAUUCAACGCUGUC........................................................  1         0.13
.......................................ACAUUCAACGCUGUCGGU.....................................................  1         0.13
........................................CAUUCAACGCUGUCGGUGA...................................................  15        2.73
........................................CAUUCAACGCUGUCGGUGAG..................................................  12        5.75
........................................CAUUCAACGCUGUCGGUGAGU.................................................  9         0.918
........................................CAUUCAACGCUGUCGGUGAGUU................................................  7         0.35
........................................CAUUCAACGCUGUCGGUGAGUUU...............................................  6         0.258
........................................CAUUCAACGCUGUCGGUG....................................................  3         1.08
........................................CAUUCAACGCUGUCGGU.....................................................  2         1.21
........................................CAUUCAACGCUGUCGGUGAGUUUG..............................................  2         0.0505
.........................................AUUCAACGCUGUCGGUGAG..................................................  48        17.6
.........................................AUUCAACGCUGUCGGUGAGU.................................................  35        8.33
.........................................AUUCAACGCUGUCGGUGAGUUU...............................................  14        0.922
.........................................AUUCAACGCUGUCGGUGAGUU................................................  10        0.787
.........................................AUUCAACGCUGUCGGUGA...................................................  7         3.09
.........................................AUUCAACGCUGUCGGU.....................................................  5         1.5
.........................................AUUCAACGCUGUCGGUG....................................................  2         0.217
..........................................UUCAACGCUGUCGGUGAG..................................................  13        5.26
..........................................UUCAACGCUGUCGGUGAGUU................................................  13        3.33
..........................................UUCAACGCUGUCGGUGAGU.................................................  11        5.57
..........................................UUCAACGCUGUCGGUGA...................................................  5         1.62
..........................................UUCAACGCUGUCGGUGAGUUU...............................................  3         0.182
..........................................UUCAACGCUGUCGGU.....................................................  3         0.496
...........................................UCAACGCUGUCGGUGAG..................................................  4         0.82
...........................................UCAACGCUGUCGGUGAGUU................................................  3         0.289
...........................................UCAACGCUGUCGGUGAGU.................................................  2         1.79
...........................................UCAACGCUGUCGGUGAGUUU...............................................  2         0.141
............................................CAACGCUGUCGGUGA...................................................  6         5.47
............................................CAACGCUGUCGGUGAGUUU...............................................  4         2.86
............................................CAACGCUGUCGGUGAGUU................................................  3         5.48
............................................CAACGCUGUCGGUGAG..................................................  3         1.08
............................................CAACGCUGUCGGUGAGU.................................................  3         2.65
.............................................AACGCUGUCGGUGAGU.................................................  4         5.95
.............................................AACGCUGUCGGUGAGUU................................................  4         4.05
.............................................AACGCUGUCGGUGAG..................................................  3         4.34
.............................................AACGCUGUCGGUGAGUUU...............................................  2         2.47
..............................................ACGCUGUCGGUGAGU.................................................  3         4.23
..............................................ACGCUGUCGGUGAGUU................................................  1         0.5
................................................GCUGUCGGUGAGUUU...............................................  3         7.98
...........................................................................AACCACUGACCGUUGACUGUA..............  294       12.6
...........................................................................AACCACUGACCGUUGACUGU...............  136       5.7
...........................................................................AACCACUGACCGUUGACUGUAC.............  72        4.78
...........................................................................AACCACUGACCGUUGACUG................  15        0.426
...........................................................................AACCACUGACCGUUGACUGUACC............  14        0.644
............................................................................ACCACUGACCGUUGACUGUA..............  2546      101
............................................................................ACCACUGACCGUUGACUGUACC............  2114      193
............................................................................ACCACUGACCGUUGACUGUAC.............  1193      77.6
............................................................................ACCACUGACCGUUGACUGU...............  1001      40.9
............................................................................ACCACUGACCGUUGACUGUACCU...........  75        4.31
............................................................................ACCACUGACCGUUGACUG................  25        0.854
............................................................................ACCACUGACCGUUGACU.................  2         0.0836
............................................................................ACCACUGACCGUUGA...................  1         0.536
.............................................................................CCACUGACCGUUGACUGUAC.............  1         0.0252
..............................................................................CACUGACCGUUGACUGUACC............  3         2.09
..............................................................................CACUGACCGUUGACUGUAC.............  1         0.0332
...............................................................................ACUGACCGUUGACUGUACC............  2         0.141
AGAAGGGCUAUCAGGCCAGCCUUCAGAGGACUCCAAGGAACAUUCAACGCUGUCGGUGAGUUUGGGAUUUGAAAAAACCACUGACCGUUGACUGUACCUUGGGGUCCUUA
.((((((((....)))...))))).(((((((((((((.(((.((((((..(((((((.((((...........))))))))))))))))).))).))))))))))))). (-54.00)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000002 49Embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000103 3026Melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000104 557Melanocyte GEO : GSM458536 [ Stark MS et al.]
ER0000000105 1694 GEO : GSM458537 Cell line: Primary giant congental nevus [ Stark MS et al.]
ER0000000106 230Melanoma GEO : GSM458538 Cell line: Secondary acral melanoma [ Stark MS et al.]
ER0000000107 440Melanoma GEO : GSM458539 Cell line: Secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 1748Melanoma GEO : GSM458540 Cell line: Secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 417Melanoma GEO : GSM458541 Cell line: Primary uveal melanoma [ Stark MS et al.]
ER0000000110 2358Melanoma GEO : GSM458542 Cell line: Secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 507Melanoma GEO : GSM458543 Cell line: Secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 1187Melanoma GEO : GSM458544 Cell line: Secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 774Melanoma GEO : GSM458545 Cell line: Secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 905Melanoma GEO : GSM458546 Cell line: Secondary cutaneous melanoma [ Stark MS et al.]
ER0000000135 21Uterine cervix GEO : GSM532871 [ Witten D et al.]
ER0000000136 11Squamous cell GEO : GSM532872 [ Witten D et al.]
ER0000000137 1Uterine cervix GEO : GSM532873 [ Witten D et al.]
ER0000000138 33Squamous cell GEO : GSM532874 [ Witten D et al.]
ER0000000139 2Uterine cervix GEO : GSM532875 [ Witten D et al.]
ER0000000140 28Squamous cell GEO : GSM532876 [ Witten D et al.]
ER0000000141 5Uterine cervix GEO : GSM532877 [ Witten D et al.]
ER0000000142 12Squamous cell GEO : GSM532878 [ Witten D et al.]
ER0000000144 1Squamous cell GEO : GSM532880 [ Witten D et al.]
ER0000000147 42Uterine cervix GEO : GSM532883 [ Witten D et al.]
ER0000000148 6Squamous cell GEO : GSM532884 [ Witten D et al.]
ER0000000149 9Uterine cervix GEO : GSM532885 [ Witten D et al.]
ER0000000150 16Squamous cell GEO : GSM532886 [ Witten D et al.]
ER0000000151 1Uterine cervix GEO : GSM532887 [ Witten D et al.]
ER0000000154 1Squamous cell GEO : GSM532890 [ Witten D et al.]
ER0000000155 77Uterine cervix GEO : GSM532891 [ Witten D et al.]
ER0000000156 104Squamous cell GEO : GSM532892 [ Witten D et al.]
ER0000000157 12Uterine cervix GEO : GSM532893 [ Witten D et al.]
ER0000000158 1Squamous cell GEO : GSM532894 [ Witten D et al.]
ER0000000159 590Uterine cervix GEO : GSM532895 [ Witten D et al.]
ER0000000161 157Uterine cervix GEO : GSM532897 [ Witten D et al.]
ER0000000163 116Uterine cervix GEO : GSM532899 [ Witten D et al.]
ER0000000164 203Squamous cell GEO : GSM532900 [ Witten D et al.]
ER0000000165 92Uterine cervix GEO : GSM532901 [ Witten D et al.]
ER0000000166 2Squamous cell GEO : GSM532902 [ Witten D et al.]
ER0000000167 101Uterine cervix GEO : GSM532903 [ Witten D et al.]
ER0000000168 9Adenosquamous cell GEO : GSM532904 [ Witten D et al.]
ER0000000170 2Adenosquamous cell GEO : GSM532906 [ Witten D et al.]
ER0000000171 88Uterine cervix GEO : GSM532907 [ Witten D et al.]
ER0000000173 122Uterine cervix GEO : GSM532909 [ Witten D et al.]
ER0000000174 97Squamous cell GEO : GSM532910 [ Witten D et al.]
ER0000000175 2Uterine cervix GEO : GSM532911 [ Witten D et al.]
ER0000000176 40Adenosquamous cell GEO : GSM532912 [ Witten D et al.]
ER0000000177 407Uterine cervix GEO : GSM532913 [ Witten D et al.]
ER0000000178 39Squamous cell GEO : GSM532914 [ Witten D et al.]
ER0000000179 66Uterine cervix GEO : GSM532915 [ Witten D et al.]
ER0000000180 61Squamous cell GEO : GSM532916 [ Witten D et al.]
ER0000000181 26Uterine cervix GEO : GSM532917 [ Witten D et al.]
ER0000000182 8Squamous cell GEO : GSM532918 [ Witten D et al.]
ER0000000183 60Uterine cervix GEO : GSM532919 [ Witten D et al.]
ER0000000184 188Squamous cell GEO : GSM532920 [ Witten D et al.]
ER0000000185 596Uterine cervix GEO : GSM532921 [ Witten D et al.]
ER0000000186 373Squamous cell GEO : GSM532922 [ Witten D et al.]
ER0000000187 253Uterine cervix GEO : GSM532923 [ Witten D et al.]
ER0000000190 23Squamous cell GEO : GSM532926 [ Witten D et al.]
ER0000000262 1 GEO : GSM337570 Antibody: anti-Ago1 4B8
ER0000000263 3 GEO : GSM337571 Antibody: anti-Ago2 11A9
ER0000000264 12Undifferentiated NPC GEO : GSM368181 [ Zhu JY et al.]
ER0000000265 2Clinically negative of NPC GEO : GSM368182 [ Zhu JY et al.]
ER0000000266 5Undifferentiated NPC GEO : GSM368183 [ Zhu JY et al.]
ER0000000277 9056Tonsil GEO : GSM569185 Cell type: Centroblast; Gender: Female; Age: 3 years; Isolation: Fluorescence activated cell sorting [ Kuchen S et al.]
ER0000000278 10704Tonsil GEO : GSM569186 Cell type: Centrocyte; Gender: Female; Age: 3 years; Isolation: Fluorescence activated cell sorting [ Kuchen S et al.]
ER0000000279 34874Tonsil GEO : GSM569187 Cell type: Pre-germinal center B cell; Gender: Female; Age: 3 years; Isolation: Fluorescence activated cell sorting [ Kuchen S et al.]
ER0000000280 20554Tonsil GEO : GSM569188 Cell type: Plasma cell; Gender: Female; Age: 3 years; Isolation: Fluorescence activated cell sorting [ Kuchen S et al.]
ER0000000281 18561Tonsil GEO : GSM569189 Cell type: Naive B cell; Gender: Female; Age: 5 years; Isolation: Fluorescence activated cell sorting [ Kuchen S et al.]
ER0000000282 6781Tonsil GEO : GSM569190 Cell type: Memory B cell; Gender: Female; Age: 5 years; Isolation: Fluorescence activated cell sorting [ Kuchen S et al.]
ER0000000480 307544Frontal Cortex GEO : GSM995300 Age: 63 years; Gender: Male [ Meunier J et al.]
ER0000000481 233571Cerebellum GEO : GSM995301 Age: 68 years; Gender: Male [ Meunier J et al.]
ER0000000482 19902Heart GEO : GSM995302 Age: 29 years; Gender: Male [ Meunier J et al.]
ER0000000483 22413Kidney GEO : GSM995303 Age: 26 years; Gender: Male [ Meunier J et al.]
ER0000000484 2588Testis GEO : GSM995304 Age: 51 years; Gender: Male [ Meunier J et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
3
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
4
5
PMID:20605486 "Regulation of microRNA expression and abundance during lymphopoiesis" Kuchen S, Resch W, Yamane A, Kuo N, Li Z, Chakraborty T, Wei L, Laurence A, Yasuda T, Peng S, Hu-Li J, Lu K, Dubois W, Kitamura Y, Charles N, Sun HW, Muljo S, Schwartzberg PL, Paul WE, O'Shea J, Rajewsky K, Casellas R Immunity. 32:828-839(2010).
6
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).