Deep sequencing reads for stem-loop sequence MI0000269

Stem-loop IDhsa-mir-181a-2
Confidence
Feedback: Do you believe this miRNA is real?
Reads
                                     hsa-miR-181a-5p                    hsa-miR-181a-2-3p                       Count     RPM (mean number of reads per million)
..................GCCUUCAGAGGACUCCAAGG........................................................................  10        0.484
...................CCUUCAGAGGACUCCAAGG........................................................................  15        2.72
....................CUUCAGAGGACUCCAAGG........................................................................  7         0.38
.....................UUCAGAGGACUCCAAGG........................................................................  2         0.141
.....................................GAACAUUCAACGCUGUCGGUG....................................................  58        1.7
.....................................GAACAUUCAACGCUGUCGGUGA...................................................  42        1.54
.....................................GAACAUUCAACGCUGUCGGUGAG..................................................  40        2.9
.....................................GAACAUUCAACGCUGUCGGU.....................................................  34        1.69
.....................................GAACAUUCAACGCUGUCGGUGAGU.................................................  14        0.73
.....................................GAACAUUCAACGCUGUCGGUGAGUUU...............................................  9         0.526
.....................................GAACAUUCAACGCUG..........................................................  1         0.00132
......................................AACAUUCAACGCUGUCGGUG....................................................  39384     1.19e+03
......................................AACAUUCAACGCUGUCGGU.....................................................  10415     373
......................................AACAUUCAACGCUGUCGGUGA...................................................  412       3.27
......................................AACAUUCAACGCUGUCGGUGAGU.................................................  286       2.73
......................................AACAUUCAACGCUGUCGGUGAGUUUG..............................................  157       5.38
......................................AACAUUCAACGCUGUCGGUGAG..................................................  133       8.48
......................................AACAUUCAACGCUGUCGGUGAGUU................................................  68        6.18
......................................AACAUUCAACGCUGUCGG......................................................  46        1.53
......................................AACAUUCAACGCUGUCGGUGAGUUU...............................................  11        2.03
......................................AACAUUCAACGCUGUCG.......................................................  7         1.84
......................................AACAUUCAACGCUGU.........................................................  6         2.46
......................................AACAUUCAACGCUGUC........................................................  4         2.33
......................................AACAUUCAACGCUGUCGGUGAGUUUGGGAU..........................................  3         0.0884
.......................................ACAUUCAACGCUGUCGGUGAGUU................................................  170       8.72
.......................................ACAUUCAACGCUGUCGGUGAG..................................................  121       10.1
.......................................ACAUUCAACGCUGUCGGUGAGUUU...............................................  117       6.18
.......................................ACAUUCAACGCUGUCGGUGAGU.................................................  80        5.95
.......................................ACAUUCAACGCUGUCGGUGA...................................................  37        4.34
.......................................ACAUUCAACGCUGUCGGUG....................................................  20        2.04
.......................................ACAUUCAACGCUGUC........................................................  1         0.13
.......................................ACAUUCAACGCUGUCGGU.....................................................  1         0.13
........................................CAUUCAACGCUGUCGGUGA...................................................  15        2.73
........................................CAUUCAACGCUGUCGGUGAG..................................................  12        5.75
........................................CAUUCAACGCUGUCGGUGAGU.................................................  9         0.918
........................................CAUUCAACGCUGUCGGUGAGUU................................................  7         0.35
........................................CAUUCAACGCUGUCGGUGAGUUU...............................................  6         0.258
........................................CAUUCAACGCUGUCGGUG....................................................  3         1.08
........................................CAUUCAACGCUGUCGGU.....................................................  2         1.21
........................................CAUUCAACGCUGUCGGUGAGUUUG..............................................  2         0.0505
.........................................AUUCAACGCUGUCGGUGAG..................................................  48        17.6
.........................................AUUCAACGCUGUCGGUGAGU.................................................  35        8.33
.........................................AUUCAACGCUGUCGGUGAGUUU...............................................  14        0.922
.........................................AUUCAACGCUGUCGGUGAGUU................................................  10        0.787
.........................................AUUCAACGCUGUCGGUGA...................................................  7         3.09
.........................................AUUCAACGCUGUCGGU.....................................................  5         1.5
.........................................AUUCAACGCUGUCGGUG....................................................  2         0.217
..........................................UUCAACGCUGUCGGUGAG..................................................  13        5.26
..........................................UUCAACGCUGUCGGUGAGUU................................................  13        3.33
..........................................UUCAACGCUGUCGGUGAGU.................................................  11        5.57
..........................................UUCAACGCUGUCGGUGA...................................................  5         1.62
..........................................UUCAACGCUGUCGGUGAGUUU...............................................  3         0.182
..........................................UUCAACGCUGUCGGU.....................................................  3         0.496
...........................................UCAACGCUGUCGGUGAG..................................................  4         0.82
...........................................UCAACGCUGUCGGUGAGUU................................................  3         0.289
...........................................UCAACGCUGUCGGUGAGU.................................................  2         1.79
...........................................UCAACGCUGUCGGUGAGUUU...............................................  2         0.141
............................................CAACGCUGUCGGUGA...................................................  6         5.47
............................................CAACGCUGUCGGUGAGUUU...............................................  4         2.86
............................................CAACGCUGUCGGUGAGUU................................................  3         5.48
............................................CAACGCUGUCGGUGAG..................................................  3         1.08
............................................CAACGCUGUCGGUGAGU.................................................  3         2.65
.............................................AACGCUGUCGGUGAGU.................................................  4         5.95
.............................................AACGCUGUCGGUGAGUU................................................  4         4.05
.............................................AACGCUGUCGGUGAG..................................................  3         4.34
.............................................AACGCUGUCGGUGAGUUU...............................................  2         2.47
..............................................ACGCUGUCGGUGAGU.................................................  3         4.23
..............................................ACGCUGUCGGUGAGUU................................................  1         0.5
................................................GCUGUCGGUGAGUUU...............................................  3         7.98
...........................................................................AACCACUGACCGUUGACUGUA..............  294       12.6
...........................................................................AACCACUGACCGUUGACUGU...............  136       5.7
...........................................................................AACCACUGACCGUUGACUGUAC.............  72        4.78
...........................................................................AACCACUGACCGUUGACUG................  15        0.426
...........................................................................AACCACUGACCGUUGACUGUACC............  14        0.644
............................................................................ACCACUGACCGUUGACUGUA..............  2546      101
............................................................................ACCACUGACCGUUGACUGUACC............  2114      193
............................................................................ACCACUGACCGUUGACUGUAC.............  1193      77.6
............................................................................ACCACUGACCGUUGACUGU...............  1001      40.9
............................................................................ACCACUGACCGUUGACUGUACCU...........  75        4.31
............................................................................ACCACUGACCGUUGACUG................  25        0.854
............................................................................ACCACUGACCGUUGACU.................  2         0.0836
............................................................................ACCACUGACCGUUGA...................  1         0.536
.............................................................................CCACUGACCGUUGACUGUAC.............  1         0.0252
..............................................................................CACUGACCGUUGACUGUACC............  3         2.09
..............................................................................CACUGACCGUUGACUGUAC.............  1         0.0332
...............................................................................ACUGACCGUUGACUGUACC............  2         0.141
AGAAGGGCUAUCAGGCCAGCCUUCAGAGGACUCCAAGGAACAUUCAACGCUGUCGGUGAGUUUGGGAUUUGAAAAAACCACUGACCGUUGACUGUACCUUGGGGUCCUUA
.((((((((....)))...))))).(((((((((((((.(((.((((((..(((((((.((((...........))))))))))))))))).))).))))))))))))). (-54.00)

Filter reads

by experiment
AccessionRead countTissueLinkCommentReference
ER0000000002 49Embryonic stem cellGEO : GSM541797 [ Bar M et al.]
ER0000000103 3026MelanoblastGEO : GSM458535 [ Stark MS et al.]
ER0000000104 557MelanocyteGEO : GSM458536 [ Stark MS et al.]
ER0000000105 1694GEO : GSM458537Cell line: Primary giant congental nevus[ Stark MS et al.]
ER0000000106 230MelanomaGEO : GSM458538Cell line: Secondary acral melanoma[ Stark MS et al.]
ER0000000107 440MelanomaGEO : GSM458539Cell line: Secondary mucosal melanoma[ Stark MS et al.]
ER0000000108 1748MelanomaGEO : GSM458540Cell line: Secondary cutaneous melanoma[ Stark MS et al.]
ER0000000109 417MelanomaGEO : GSM458541Cell line: Primary uveal melanoma[ Stark MS et al.]
ER0000000110 2358MelanomaGEO : GSM458542Cell line: Secondary cutaneous melanoma[ Stark MS et al.]
ER0000000111 507MelanomaGEO : GSM458543Cell line: Secondary cutaneous melanoma[ Stark MS et al.]
ER0000000112 1187MelanomaGEO : GSM458544Cell line: Secondary cutaneous melanoma[ Stark MS et al.]
ER0000000113 774MelanomaGEO : GSM458545Cell line: Secondary cutaneous melanoma from a chronically sun-damaged body site[ Stark MS et al.]
ER0000000114 905MelanomaGEO : GSM458546Cell line: Secondary cutaneous melanoma[ Stark MS et al.]
ER0000000135 21Uterine cervixGEO : GSM532871 [ Witten D et al.]
ER0000000136 11Squamous cellGEO : GSM532872 [ Witten D et al.]
ER0000000137 1Uterine cervixGEO : GSM532873 [ Witten D et al.]
ER0000000138 33Squamous cellGEO : GSM532874 [ Witten D et al.]
ER0000000139 2Uterine cervixGEO : GSM532875 [ Witten D et al.]
ER0000000140 28Squamous cellGEO : GSM532876 [ Witten D et al.]
ER0000000141 5Uterine cervixGEO : GSM532877 [ Witten D et al.]
ER0000000142 12Squamous cellGEO : GSM532878 [ Witten D et al.]
ER0000000144 1Squamous cellGEO : GSM532880 [ Witten D et al.]
ER0000000147 42Uterine cervixGEO : GSM532883 [ Witten D et al.]
ER0000000148 6Squamous cellGEO : GSM532884 [ Witten D et al.]
ER0000000149 9Uterine cervixGEO : GSM532885 [ Witten D et al.]
ER0000000150 16Squamous cellGEO : GSM532886 [ Witten D et al.]
ER0000000151 1Uterine cervixGEO : GSM532887 [ Witten D et al.]
ER0000000154 1Squamous cellGEO : GSM532890 [ Witten D et al.]
ER0000000155 77Uterine cervixGEO : GSM532891 [ Witten D et al.]
ER0000000156 104Squamous cellGEO : GSM532892 [ Witten D et al.]
ER0000000157 12Uterine cervixGEO : GSM532893 [ Witten D et al.]
ER0000000158 1Squamous cellGEO : GSM532894 [ Witten D et al.]
ER0000000159 590Uterine cervixGEO : GSM532895 [ Witten D et al.]
ER0000000161 157Uterine cervixGEO : GSM532897 [ Witten D et al.]
ER0000000163 116Uterine cervixGEO : GSM532899 [ Witten D et al.]
ER0000000164 203Squamous cellGEO : GSM532900 [ Witten D et al.]
ER0000000165 92Uterine cervixGEO : GSM532901 [ Witten D et al.]
ER0000000166 2Squamous cellGEO : GSM532902 [ Witten D et al.]
ER0000000167 101Uterine cervixGEO : GSM532903 [ Witten D et al.]
ER0000000168 9Adenosquamous cellGEO : GSM532904 [ Witten D et al.]
ER0000000170 2Adenosquamous cellGEO : GSM532906 [ Witten D et al.]
ER0000000171 88Uterine cervixGEO : GSM532907 [ Witten D et al.]
ER0000000173 122Uterine cervixGEO : GSM532909 [ Witten D et al.]
ER0000000174 97Squamous cellGEO : GSM532910 [ Witten D et al.]
ER0000000175 2Uterine cervixGEO : GSM532911 [ Witten D et al.]
ER0000000176 40Adenosquamous cellGEO : GSM532912 [ Witten D et al.]
ER0000000177 407Uterine cervixGEO : GSM532913 [ Witten D et al.]
ER0000000178 39Squamous cellGEO : GSM532914 [ Witten D et al.]
ER0000000179 66Uterine cervixGEO : GSM532915 [ Witten D et al.]
ER0000000180 61Squamous cellGEO : GSM532916 [ Witten D et al.]
ER0000000181 26Uterine cervixGEO : GSM532917 [ Witten D et al.]
ER0000000182 8Squamous cellGEO : GSM532918 [ Witten D et al.]
ER0000000183 60Uterine cervixGEO : GSM532919 [ Witten D et al.]
ER0000000184 188Squamous cellGEO : GSM532920 [ Witten D et al.]
ER0000000185 596Uterine cervixGEO : GSM532921 [ Witten D et al.]
ER0000000186 373Squamous cellGEO : GSM532922 [ Witten D et al.]
ER0000000187 253Uterine cervixGEO : GSM532923 [ Witten D et al.]
ER0000000190 23Squamous cellGEO : GSM532926 [ Witten D et al.]
ER0000000262 1GEO : GSM337570Antibody: anti-Ago1 4B8
ER0000000263 3GEO : GSM337571Antibody: anti-Ago2 11A9
ER0000000264 12Undifferentiated NPCGEO : GSM368181 [ Zhu JY et al.]
ER0000000265 2Clinically negative of NPCGEO : GSM368182 [ Zhu JY et al.]
ER0000000266 5Undifferentiated NPCGEO : GSM368183 [ Zhu JY et al.]
ER0000000277 9056TonsilGEO : GSM569185Cell type: Centroblast; Gender: Female; Age: 3 years; Isolation: Fluorescence activated cell sorting[ Kuchen S et al.]
ER0000000278 10704TonsilGEO : GSM569186Cell type: Centrocyte; Gender: Female; Age: 3 years; Isolation: Fluorescence activated cell sorting[ Kuchen S et al.]
ER0000000279 34874TonsilGEO : GSM569187Cell type: Pre-germinal center B cell; Gender: Female; Age: 3 years; Isolation: Fluorescence activated cell sorting[ Kuchen S et al.]
ER0000000280 20554TonsilGEO : GSM569188Cell type: Plasma cell; Gender: Female; Age: 3 years; Isolation: Fluorescence activated cell sorting[ Kuchen S et al.]
ER0000000281 18561TonsilGEO : GSM569189Cell type: Naive B cell; Gender: Female; Age: 5 years; Isolation: Fluorescence activated cell sorting[ Kuchen S et al.]
ER0000000282 6781TonsilGEO : GSM569190Cell type: Memory B cell; Gender: Female; Age: 5 years; Isolation: Fluorescence activated cell sorting[ Kuchen S et al.]
ER0000000480 307544Frontal CortexGEO : GSM995300Age: 63 years; Gender: Male[ Meunier J et al.]
ER0000000481 233571CerebellumGEO : GSM995301Age: 68 years; Gender: Male[ Meunier J et al.]
ER0000000482 19902HeartGEO : GSM995302Age: 29 years; Gender: Male[ Meunier J et al.]
ER0000000483 22413KidneyGEO : GSM995303Age: 26 years; Gender: Male[ Meunier J et al.]
ER0000000484 2588TestisGEO : GSM995304Age: 51 years; Gender: Male[ Meunier J et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
3
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
4
5
PMID:20605486 "Regulation of microRNA expression and abundance during lymphopoiesis" Kuchen S, Resch W, Yamane A, Kuo N, Li Z, Chakraborty T, Wei L, Laurence A, Yasuda T, Peng S, Hu-Li J, Lu K, Dubois W, Kitamura Y, Charles N, Sun HW, Muljo S, Schwartzberg PL, Paul WE, O'Shea J, Rajewsky K, Casellas R Immunity. 32:828-839(2010).
6
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).