Deep sequencing reads for stem-loop sequence MI0000239

Stem-loop ID hsa-mir-197
Reads
        hsa-miR-197-5p                        hsa-miR-197-3p                 Count     RPM (mean number of reads per million)
........CGGGUAGAGAGGGCAGUGGGAGG............................................  93        2.11
........CGGGUAGAGAGGGCAGUGGGAG.............................................  54        1.03
........CGGGUAGAGAGGGCAGUGGGAGGU...........................................  10        0.168
........CGGGUAGAGAGGGCAGUGGGA..............................................  8         0.195
........CGGGUAGAGAGGGCAGUGG................................................  4         0.109
........CGGGUAGAGAGGGCAGUG.................................................  2         0.0257
............................................CCCUUCACCACCUUCUCCACCCAGC......  81        880
............................................CCCUUCACCACCUUCUCCACCCAG.......  60        395
............................................CCCUUCACCACCUUCUCCACCCAGCA.....  9         63
............................................CCCUUCACCACCUUCUCCACCCA........  8         95.5
............................................CCCUUCACCACCUUCUCCAC...........  2         15
............................................CCCUUCACCACCUUCUCCACCC.........  1         9.78
............................................CCCUUCACCACCUUCUC..............  1         9.78
...............................................UUCACCACCUUCUCCACCCAGC......  440       31.3
...............................................UUCACCACCUUCUCCACCCAG.......  114       12.5
...............................................UUCACCACCUUCUCCACCCAGCA.....  27        0.638
...............................................UUCACCACCUUCUCCACCCA........  1         0.316
................................................UCACCACCUUCUCCACCCAGCA.....  3         0.949
GGCUGUGCCGGGUAGAGAGGGCAGUGGGAGGUAAGAGCUCUUCACCCUUCACCACCUUCUCCACCCAGCAUGGCC
((((((((.((((.(((((((..((((..((((((....))).)))..))))..))))))).)))).)))))))) (-42.40)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 2embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000002 19embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000103 156melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000104 23melanocyte GEO : GSM458536 [ Stark MS et al.]
ER0000000105 83 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000106 7melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000107 109melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 130melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 37melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000110 89melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 53melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 42melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 74melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 60melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000135 1 GEO : GSM532871 normal cervix [ Witten D et al.]
ER0000000141 3 GEO : GSM532877 normal cervix [ Witten D et al.]
ER0000000147 6 GEO : GSM532883 normal cervix [ Witten D et al.]
ER0000000156 1squamous cell GEO : GSM532892 [ Witten D et al.]
ER0000000157 13 GEO : GSM532893 normal cervix [ Witten D et al.]
ER0000000161 74 GEO : GSM532897 normal cervix [ Witten D et al.]
ER0000000165 116 GEO : GSM532901 normal cervix [ Witten D et al.]
ER0000000169 42 GEO : GSM532905 normal cervix [ Witten D et al.]
ER0000000171 30 GEO : GSM532907 normal cervix [ Witten D et al.]
ER0000000175 10 GEO : GSM532911 normal cervix [ Witten D et al.]
ER0000000181 48 GEO : GSM532917 normal cervix [ Witten D et al.]
ER0000000183 40whole body GEO : GSM532919 normal cervix [ Witten D et al.]
ER0000000262 9 GEO : GSM337570 antibody: anti-Ago1 4B8
ER0000000263 12 GEO : GSM337571 antibody: anti-Ago2 11A9
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
3