Deep sequencing reads for stem-loop sequence MI0000213

Stem-loop ID ath-MIR170
Reads 
                                                             ath-miR170                       Count     RPM (mean number of reads per million)
.................UAUUGGCCUGGUUCACUCAGA.......................................................  150       220
.........................................................CUGAUUGAGCCGUGUCAAUAUC..............  1         2.71
..........................................................UGAUUGAGCCGUGUCAAUAUC..............  1680      4.89e+03
..........................................................UGAUUGAGCCGUGUCAAUA................  25        2.26
..........................................................UGAUUGAGCCGUGUCAAUAU...............  15        7.15
..........................................................UGAUUGAGCCGUGUCAAUAUCU.............  2         5.58
...........................................................GAUUGAGCCGUGUCAAUAUC..............  1         2.87
.............................................................UUGAGCCGUGUCAAUAUC..............  1         2.87
..............................................................UGAGCCGUGUCAAUAUC..............  1         2.87
CGAGAGAGUCCCUCUGAUAUUGGCCUGGUUCACUCAGAUUCUCUUUUACUAACUCAUCUGAUUGAGCCGUGUCAAUAUCUCAGUCCUCUCUCG
((((((((..(....(((((((((.(((((((.((((((................)))))).))))))).)))))))))...)..)))))))) (-40.49)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000003 967whole body GEO : GSM253622 [ Mi S et al.]
ER0000000004 3whole body GEO : GSM253623 [ Mi S et al.]
ER0000000005 180whole body GEO : GSM253624 [ Mi S et al.]
ER0000000006 34whole body GEO : GSM253625 [ Mi S et al.]
ER0000000208 304flower GEO : GSM118372 [ Rajagopalan R et al.]
ER0000000209 459rosette leaf GEO : GSM118373 [ Rajagopalan R et al.]
ER0000000210 644seedling GEO : GSM118374 [ Rajagopalan R et al.]
ER0000000211 369silique GEO : GSM118375 [ Rajagopalan R et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
2
PMID:18342361 "Sorting of small RNAs into Arabidopsis argonaute complexes is directed by the 5' terminal nucleotide" Mi S, Cai T, Hu Y, Chen Y, Hodges E, Ni F, Wu L, Li S, Zhou H, Long C, Chen S, Hannon GJ, Qi Y. Cell. 133:116-127(2008).