Deep sequencing reads for stem-loop sequence MI0000083

Stem-loop ID hsa-mir-26a-1
Reads 
         hsa-miR-26a-5p                       hsa-miR-26a-1-3p                  Count     RPM (mean number of reads per million)
........GUUCAAGUAAUCCAGGAUAGGCU..............................................  1         0.192
.........UUCAAGUAAUCCAGGAUAGGCU..............................................  24628     607
.........UUCAAGUAAUCCAGGAUAGGC...............................................  1167      190
.........UUCAAGUAAUCCAGGAUAGG................................................  648       68.4
.........UUCAAGUAAUCCAGGAUAG.................................................  99        143
.........UUCAAGUAAUCCAGGAUAGGCUGU............................................  26        0.369
.........UUCAAGUAAUCCAGGAUA..................................................  8         27.3
.........UUCAAGUAAUCCAGGAU...................................................  6         59.9
.........UUCAAGUAAUCCAGGAUAGGCUG.............................................  3         0.23
..........UCAAGUAAUCCAGGAUAGGCU..............................................  71        1.23
..........UCAAGUAAUCCAGGAUAGGCUGU............................................  2         0.0329
..........UCAAGUAAUCCAGGAUAGGC...............................................  1         0.192
...........CAAGUAAUCCAGGAUAGGCU..............................................  29        0.796
............AAGUAAUCCAGGAUAGGCU..............................................  53        2.64
..............GUAAUCCAGGAUAGGCU..............................................  9         0.13
.............................................GGGCCUAUUCUUGGUUACUUGCAC........  1         2.41
................................................CCUAUUCUUGGUUACUUGCACG.......  8         0.118
GUGGCCUCGUUCAAGUAAUCCAGGAUAGGCUGUGCAGGUCCCAAUGGGCCUAUUCUUGGUUACUUGCACGGGGACGC
(((.((((((.(((((((((.((((((((((.((.......))...)))))))))).))))))))).)))))).))) (-37.30)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 3embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000002 439embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000103 5559melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000104 2579melanocyte GEO : GSM458536 [ Stark MS et al.]
ER0000000105 6337 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000106 1253melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000107 4001melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 6353melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 2302melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000110 6527melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 3137melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 7550melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 3523melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 2893melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000136 2squamous cell GEO : GSM532872 [ Witten D et al.]
ER0000000139 1 GEO : GSM532875 normal cervix [ Witten D et al.]
ER0000000142 2squamous cell GEO : GSM532878 [ Witten D et al.]
ER0000000143 4 GEO : GSM532879 normal cervix [ Witten D et al.]
ER0000000148 3squamous cell GEO : GSM532884 [ Witten D et al.]
ER0000000149 4 GEO : GSM532885 normal cervix [ Witten D et al.]
ER0000000155 44 GEO : GSM532891 normal cervix [ Witten D et al.]
ER0000000159 6 GEO : GSM532895 normal cervix [ Witten D et al.]
ER0000000161 2 GEO : GSM532897 normal cervix [ Witten D et al.]
ER0000000162 2squamous cell GEO : GSM532898 [ Witten D et al.]
ER0000000163 2 GEO : GSM532899 normal cervix [ Witten D et al.]
ER0000000167 22 GEO : GSM532903 normal cervix [ Witten D et al.]
ER0000000170 2adenosquamous cell GEO : GSM532906 [ Witten D et al.]
ER0000000172 1squamous cell GEO : GSM532908 [ Witten D et al.]
ER0000000173 24 GEO : GSM532909 normal cervix [ Witten D et al.]
ER0000000174 1squamous cell GEO : GSM532910 [ Witten D et al.]
ER0000000176 8adenosquamous cell GEO : GSM532912 [ Witten D et al.]
ER0000000177 4 GEO : GSM532913 normal cervix [ Witten D et al.]
ER0000000179 18 GEO : GSM532915 normal cervix [ Witten D et al.]
ER0000000182 2squamous cell GEO : GSM532918 [ Witten D et al.]
ER0000000183 1whole body GEO : GSM532919 normal cervix [ Witten D et al.]
ER0000000184 2squamous cell GEO : GSM532920 [ Witten D et al.]
ER0000000185 6 GEO : GSM532921 normal cervix [ Witten D et al.]
ER0000000187 5 GEO : GSM532923 normal cervix [ Witten D et al.]
ER0000000193 11 GEO : GSM532929 normal cervix [ Witten D et al.]
ER0000000194 6squamous cell GEO : GSM532930 [ Witten D et al.]
ER0000000262 156 GEO : GSM337570 antibody: anti-Ago1 4B8
ER0000000263 45 GEO : GSM337571 antibody: anti-Ago2 11A9
ER0000000264 317 GEO : GSM368181 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000265 5 GEO : GSM368182 tissue: clinically negative of NPC [ Zhu JY et al.]
ER0000000266 17 GEO : GSM368183 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000267 11 GEO : GSM368184 tissue: clinically negative of NPC [ Zhu JY et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
3
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
4
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).