Comments on: About http://www.mirbase.org/blog miRBase news and views Thu, 09 May 2013 04:47:03 +0000 hourly 1 http://wordpress.org/?v=3.0.1 By: Mickael http://www.mirbase.org/blog/about/#comment-5975 Mickael Tue, 02 Apr 2013 00:34:40 +0000 http://www.mirbase.org/blog/?page_id=2#comment-5975 A new paper just came up in Journal of Integrative Bioinformatics: "Can MiRBase Provide Positive Data for Machine Learning for the Detection of MiRNA Hairpins?" by Saçar et al. 2013. http://journal.imbio.de/articles/pdf/jib-215.pdf Maybe some points could be answered from miRbase staff. A new paper just came up in Journal of Integrative Bioinformatics:
“Can MiRBase Provide Positive Data for Machine Learning for the Detection of MiRNA Hairpins?” by Saçar et al. 2013.
http://journal.imbio.de/articles/pdf/jib-215.pdf

Maybe some points could be answered from miRbase staff.

]]> By: sam http://www.mirbase.org/blog/about/#comment-5528 sam Fri, 15 Feb 2013 11:15:44 +0000 http://www.mirbase.org/blog/?page_id=2#comment-5528 We do have a few non-animal, non-plant miRNAs that have been published and submitted to us. The sets we don't have were not submitted, or it was agreed with authors not to deposit them. There is some controversy in the community about these. This paper for example implies that these sequences are not likely to be miRNAs: Tarver JE, Donoghue PC, Peterson KJ. Do miRNAs have a deep evolutionary history? Bioessays. 2012 34(10):857-866. doi: <a href="http://dx.doi.org/10.1002/bies.201200055" rel="nofollow">10.1002/bies.201200055</a> As I understand it, many protozoans (most trypanosomes for example) don't have the RNAi machinery, so won't have miRNAs by the current definition. That does not of course mean that they don't have interesting small RNAs. We do have a few non-animal, non-plant miRNAs that have been published and submitted to us. The sets we don’t have were not submitted, or it was agreed with authors not to deposit them. There is some controversy in the community about these. This paper for example implies that these sequences are not likely to be miRNAs:

Tarver JE, Donoghue PC, Peterson KJ. Do miRNAs have a deep evolutionary
history? Bioessays. 2012 34(10):857-866. doi: 10.1002/bies.201200055

As I understand it, many protozoans (most trypanosomes for example) don’t have the RNAi machinery, so won’t have miRNAs by the current definition. That does not of course mean that they don’t have interesting small RNAs.

]]> By: maren http://www.mirbase.org/blog/about/#comment-5495 maren Thu, 07 Feb 2013 20:23:31 +0000 http://www.mirbase.org/blog/?page_id=2#comment-5495 I just wandered why there are no miRNAs from protozoan parasites deposited in the miRBase. For example, there are papers by Wang C team on Giardia lamblia miRNAs that are validated by Northern blot and other techniques (for example: Li et al, 2012. Cellular Microbiology 14, 1455-1473). Also from Toxoplasma gondii (Braun L et al 2010 Plos Pathogens Volume 6, Issue 5 e1000920. Did you ever received these miRNAs? I just wandered why there are no miRNAs from protozoan parasites deposited in the miRBase. For example, there are papers by Wang C team on Giardia lamblia miRNAs that are validated by Northern blot and other techniques (for example: Li et al, 2012. Cellular Microbiology 14, 1455-1473). Also from Toxoplasma gondii (Braun L et al 2010 Plos Pathogens Volume 6, Issue 5 e1000920. Did you ever received these miRNAs?

]]> By: Rjthomp2 http://www.mirbase.org/blog/about/#comment-3042 Rjthomp2 Tue, 14 Aug 2012 15:39:41 +0000 http://www.mirbase.org/blog/?page_id=2#comment-3042 Nevermind; I found the tutorial :) https://www.softchalkcloud.com/lesson/files/Ii14UlfmgGAoZy/index.html Nevermind; I found the tutorial :) https://www.softchalkcloud.com/lesson/files/Ii14UlfmgGAoZy/index.html

]]> By: Rjthomp2 http://www.mirbase.org/blog/about/#comment-3039 Rjthomp2 Tue, 14 Aug 2012 13:39:45 +0000 http://www.mirbase.org/blog/?page_id=2#comment-3039 I am new to the world of microRNA, and I am trying to figure out all of the rules of nomenclature and understanding the information in the database. Can someone explain what exactly "reads per million" or RPM means? I know it relates to expression of the microRNA, but what exactly is a "read" and how is this calculated? I am new to the world of microRNA, and I am trying to figure out all of the rules of nomenclature and understanding the information in the database. Can someone explain what exactly “reads per million” or RPM means? I know it relates to expression of the microRNA, but what exactly is a “read” and how is this calculated?

]]> By: andrea http://www.mirbase.org/blog/about/#comment-2051 andrea Wed, 18 Jan 2012 15:44:49 +0000 http://www.mirbase.org/blog/?page_id=2#comment-2051 Thank you. Thank you.

]]> By: sam http://www.mirbase.org/blog/about/#comment-2049 sam Wed, 18 Jan 2012 09:31:59 +0000 http://www.mirbase.org/blog/?page_id=2#comment-2049 The sequences are all complete in the <a href="ftp://mirbase.org/pub/mirbase/CURRENT/hairpin.fa.gz" rel="nofollow">hairpin.fa</a> file. The shorter sequence you show is just the first line of the hairpin sequence. All entries longer than 60nts span more than one line in that file. The sequences are all complete in the hairpin.fa file. The shorter sequence you show is just the first line of the hairpin sequence. All entries longer than 60nts span more than one line in that file.

]]> By: andrea http://www.mirbase.org/blog/about/#comment-2045 andrea Wed, 18 Jan 2012 02:34:12 +0000 http://www.mirbase.org/blog/?page_id=2#comment-2045 PS: mmu-miR-151 is another such case where the hairpin.fa sequence is truncated and so excludes mature mmu-miR-151-3p... PS: mmu-miR-151 is another such case where the hairpin.fa sequence is truncated and so excludes mature mmu-miR-151-3p…

]]> By: andrea http://www.mirbase.org/blog/about/#comment-2044 andrea Wed, 18 Jan 2012 02:22:37 +0000 http://www.mirbase.org/blog/?page_id=2#comment-2044 Hi, could you please check the mmu-mir-378 entry? The website says for the precursor hairpin: >mmu-mir-378 MI0000795 AGGGCUCCUGACUCCAGGUCCUGUGUGUUACCUCGAAAUAGCACUGGACUUGGAGUCAGAAGGCCU but your bulk download file hairpin.fa (release 18) sequence is shorter: >mmu-mir-378 MI0000795 Mus musculus miR-378 stem-loop AGGGCUCCUGACUCCAGGUCCUGUGUGUUACCUCGAAAUAGCACUGGACUUGGAGUCAGA which gives problems when aligning to this file because you cannot find mature >mmu-miR-378-3p MIMAT0003151 ACUGGACUUGGAGUCAGAAGG And are there perhaps more such cases? Thanks. Hi, could you please check the mmu-mir-378 entry? The website says for the precursor hairpin:
>mmu-mir-378 MI0000795
AGGGCUCCUGACUCCAGGUCCUGUGUGUUACCUCGAAAUAGCACUGGACUUGGAGUCAGAAGGCCU
but your bulk download file hairpin.fa (release 18) sequence is shorter:
>mmu-mir-378 MI0000795 Mus musculus miR-378 stem-loop
AGGGCUCCUGACUCCAGGUCCUGUGUGUUACCUCGAAAUAGCACUGGACUUGGAGUCAGA
which gives problems when aligning to this file because you cannot find mature
>mmu-miR-378-3p MIMAT0003151
ACUGGACUUGGAGUCAGAAGG
And are there perhaps more such cases? Thanks.

]]> By: sam http://www.mirbase.org/blog/about/#comment-808 sam Thu, 17 Feb 2011 16:16:51 +0000 http://www.mirbase.org/blog/?page_id=2#comment-808 I don't think miRBase has had a release since Zv9 came out. Each time we build a release we aim to use the most recent assemblies in EnsEMBL and elsewhere, so next time will include coordinates on the Zv9 release. In the meantime, the gff file of coordinates on Zv8 (ftp://mirbase.org/pub/mirbase/16/genomes/dre.gff) can be lifted over to Zv9 at UCSC (http://genome.ucsc.edu/cgi-bin/hgLiftOver). I don’t think miRBase has had a release since Zv9 came out. Each time we build a release we aim to use the most recent assemblies in EnsEMBL and elsewhere, so next time will include coordinates on the Zv9 release. In the meantime, the gff file of coordinates on Zv8 (ftp://mirbase.org/pub/mirbase/16/genomes/dre.gff) can be lifted over to Zv9 at UCSC (http://genome.ucsc.edu/cgi-bin/hgLiftOver).

]]>