Skip to content


About

News, views, releases, features, comment, feedback, abuse.  It’ll all be here.


13 Responses

Stay in touch with the conversation, subscribe to the RSS feed for comments on this post.

  1. Chirag says

    The Zebrafish new assembly (Zv9) has been out (in Ensembl and UCSC) for a while, yet the miRNA tracks in miRBase has not been updated yet. Does anyone has an idea, when the miRNA annotations in Zv9 be released.

  2. sam says

    I don’t think miRBase has had a release since Zv9 came out. Each time we build a release we aim to use the most recent assemblies in EnsEMBL and elsewhere, so next time will include coordinates on the Zv9 release. In the meantime, the gff file of coordinates on Zv8 (ftp://mirbase.org/pub/mirbase/16/genomes/dre.gff) can be lifted over to Zv9 at UCSC (http://genome.ucsc.edu/cgi-bin/hgLiftOver).

  3. andrea says

    Hi, could you please check the mmu-mir-378 entry? The website says for the precursor hairpin:
    >mmu-mir-378 MI0000795
    AGGGCUCCUGACUCCAGGUCCUGUGUGUUACCUCGAAAUAGCACUGGACUUGGAGUCAGAAGGCCU
    but your bulk download file hairpin.fa (release 18) sequence is shorter:
    >mmu-mir-378 MI0000795 Mus musculus miR-378 stem-loop
    AGGGCUCCUGACUCCAGGUCCUGUGUGUUACCUCGAAAUAGCACUGGACUUGGAGUCAGA
    which gives problems when aligning to this file because you cannot find mature
    >mmu-miR-378-3p MIMAT0003151
    ACUGGACUUGGAGUCAGAAGG
    And are there perhaps more such cases? Thanks.

    • andrea says

      PS: mmu-miR-151 is another such case where the hairpin.fa sequence is truncated and so excludes mature mmu-miR-151-3p…

  4. sam says

    The sequences are all complete in the hairpin.fa file. The shorter sequence you show is just the first line of the hairpin sequence. All entries longer than 60nts span more than one line in that file.

  5. Rjthomp2 says

    I am new to the world of microRNA, and I am trying to figure out all of the rules of nomenclature and understanding the information in the database. Can someone explain what exactly “reads per million” or RPM means? I know it relates to expression of the microRNA, but what exactly is a “read” and how is this calculated?

  6. Rjthomp2 says

    Nevermind; I found the tutorial :) https://www.softchalkcloud.com/lesson/files/Ii14UlfmgGAoZy/index.html

  7. maren says

    I just wandered why there are no miRNAs from protozoan parasites deposited in the miRBase. For example, there are papers by Wang C team on Giardia lamblia miRNAs that are validated by Northern blot and other techniques (for example: Li et al, 2012. Cellular Microbiology 14, 1455-1473). Also from Toxoplasma gondii (Braun L et al 2010 Plos Pathogens Volume 6, Issue 5 e1000920. Did you ever received these miRNAs?

    • sam says

      We do have a few non-animal, non-plant miRNAs that have been published and submitted to us. The sets we don’t have were not submitted, or it was agreed with authors not to deposit them. There is some controversy in the community about these. This paper for example implies that these sequences are not likely to be miRNAs:

      Tarver JE, Donoghue PC, Peterson KJ. Do miRNAs have a deep evolutionary
      history? Bioessays. 2012 34(10):857-866. doi: 10.1002/bies.201200055

      As I understand it, many protozoans (most trypanosomes for example) don’t have the RNAi machinery, so won’t have miRNAs by the current definition. That does not of course mean that they don’t have interesting small RNAs.

  8. Mickael says

    A new paper just came up in Journal of Integrative Bioinformatics:
    “Can MiRBase Provide Positive Data for Machine Learning for the Detection of MiRNA Hairpins?” by Saçar et al. 2013.
    http://journal.imbio.de/articles/pdf/jib-215.pdf

    Maybe some points could be answered from miRbase staff.

  9. ting says

    Hi, is there any way to get the genomic context of all miRNAs? In the query page, I can only get only one such info in one time like http://www.mirbase.org/cgi-bin/mirna_entry.pl?acc=MI0001729.
    Thanks!

    • sam says

      Currently the only way to get these data en masse is from the dump of the mysql database. In the database_files directory on the FTP site, there is a file called mirna_context.txt, which is a table of all miRNAs that overlap with Ensembl transcript annotations. The first column links to the file mirna.txt, which has the miRNA name and other info. The other columns of the mirna_context table are:

      transcript_id | overlap_sense | overlap_type | intron/exon number | transcript_source | transcript_name

      Any miRNA not in that table doesn’t overlap any Ensembl transcripts.



Some HTML is OK

or, reply to this post via trackback.