About

6 Responses

Stay in touch with the conversation, subscribe to the RSS feed for comments on this post.

1. Chirag says

   The Zebrafish new assembly (Zv9) has been out (in Ensembl and UCSC) for a while, yet the miRNA tracks in miRBase has not been updated yet. Does anyone has an idea, when the miRNA annotations in Zv9 be released.

   February 17, 2011, 2:26 pm Reply
2. sam says

   I don’t think miRBase has had a release since Zv9 came out. Each time we build a release we aim to use the most recent assemblies in EnsEMBL and elsewhere, so next time will include coordinates on the Zv9 release. In the meantime, the gff file of coordinates on Zv8 (ftp://mirbase.org/pub/mirbase/16/genomes/dre.gff) can be lifted over to Zv9 at UCSC (http://genome.ucsc.edu/cgi-bin/hgLiftOver).

   February 17, 2011, 4:16 pm Reply
3. andrea says

   Hi, could you please check the mmu-mir-378 entry? The website says for the precursor hairpin:
   >mmu-mir-378 MI0000795
   AGGGCUCCUGACUCCAGGUCCUGUGUGUUACCUCGAAAUAGCACUGGACUUGGAGUCAGAAGGCCU
   but your bulk download file hairpin.fa (release 18) sequence is shorter:
   >mmu-mir-378 MI0000795 Mus musculus miR-378 stem-loop
   AGGGCUCCUGACUCCAGGUCCUGUGUGUUACCUCGAAAUAGCACUGGACUUGGAGUCAGA
   which gives problems when aligning to this file because you cannot find mature
   >mmu-miR-378-3p MIMAT0003151
   ACUGGACUUGGAGUCAGAAGG
   And are there perhaps more such cases? Thanks.

   January 18, 2012, 2:22 am Reply
   • andrea says

     PS: mmu-miR-151 is another such case where the hairpin.fa sequence is truncated and so excludes mature mmu-miR-151-3p…

     January 18, 2012, 2:34 am Reply
4. sam says

   The sequences are all complete in the hairpin.fa file. The shorter sequence you show is just the first line of the hairpin sequence. All entries longer than 60nts span more than one line in that file.

   January 18, 2012, 9:31 am Reply
   • andrea says

     Thank you.

     January 18, 2012, 3:44 pm Reply