Skip to content


About

News, views, releases, features, comment, feedback, abuse.  It’ll all be here.


6 Responses

Stay in touch with the conversation, subscribe to the RSS feed for comments on this post.

  1. Chirag says

    The Zebrafish new assembly (Zv9) has been out (in Ensembl and UCSC) for a while, yet the miRNA tracks in miRBase has not been updated yet. Does anyone has an idea, when the miRNA annotations in Zv9 be released.

  2. sam says

    I don’t think miRBase has had a release since Zv9 came out. Each time we build a release we aim to use the most recent assemblies in EnsEMBL and elsewhere, so next time will include coordinates on the Zv9 release. In the meantime, the gff file of coordinates on Zv8 (ftp://mirbase.org/pub/mirbase/16/genomes/dre.gff) can be lifted over to Zv9 at UCSC (http://genome.ucsc.edu/cgi-bin/hgLiftOver).

  3. andrea says

    Hi, could you please check the mmu-mir-378 entry? The website says for the precursor hairpin:
    >mmu-mir-378 MI0000795
    AGGGCUCCUGACUCCAGGUCCUGUGUGUUACCUCGAAAUAGCACUGGACUUGGAGUCAGAAGGCCU
    but your bulk download file hairpin.fa (release 18) sequence is shorter:
    >mmu-mir-378 MI0000795 Mus musculus miR-378 stem-loop
    AGGGCUCCUGACUCCAGGUCCUGUGUGUUACCUCGAAAUAGCACUGGACUUGGAGUCAGA
    which gives problems when aligning to this file because you cannot find mature
    >mmu-miR-378-3p MIMAT0003151
    ACUGGACUUGGAGUCAGAAGG
    And are there perhaps more such cases? Thanks.

    • andrea says

      PS: mmu-miR-151 is another such case where the hairpin.fa sequence is truncated and so excludes mature mmu-miR-151-3p…

  4. sam says

    The sequences are all complete in the hairpin.fa file. The shorter sequence you show is just the first line of the hairpin sequence. All entries longer than 60nts span more than one line in that file.



Some HTML is OK

or, reply to this post via trackback.